Hair Chemistry Shouldn't Work... but it DOES!

I want to give a HUGE thanks to Frank, Frank's PI, Cyto and Leutthire for their contributions to this project!

----------------------------------------------------------------------------------------------------------------------------------
Links to articles discussed in this episode:

----------------------------------------------------------------------------------------------------------------------------------

[Relkond]

So what I’m hearing, is that you may catalyze unwanted reactions if you drop an eyelash into your chemistry.
Conclusion: Eye protection isn’t just about keeping your eyes safe.

[tfwmemedumpster]

I'm not surprised hair is dissolved by sodium hydroxide, after all they do sell it as drain cleaner and hair is one of the most common things that clogs up drains. i wouldn't say it's dissolved, more like de-polymerized, so it turns to mush with no structural integrity that gets easily suspended in solution. but i may be wrong and it might be fully dissolved

[lemon]

I can't wait for a reduction using a organic chemistry book as one of the reagents

[galliumgames]

This is cursed in all the right ways. The future of chemistry looks like this 💇🏽‍♀️🥕

[jogandsp]

A legendary moment in the lab I worked for as an undergrad was when a guy got an XRD quality crystal only because it grew on an eyelash that had fallen into the sample. He had tried and tried without luck to get good crystals before, but this chance event was the only thing that got them to grow

[Beregorn]

This study should definitely aim for the IgNobel. Also, would be nice to have a mass spectroscopy analysis of the hairs used and correlate the hairs composition with the yeld

[Mystictiki]

Considering I'm a biochemist and have seen plenty of papers and talks about chemo-enzymatic processes, the mechanism of metal nanoparticles actually looks like the most plausible in this case given most proteins and RNA that one might suspect to responsible for this chemistry will completely denature when exposed to strong base and heat.

[actualboomer]

So... The wicked Witch really DID need a lock of the princesses hair for her magic potion to work?

[AngDavies]

Seem sulfur/sulfides would be a more likely culprit than transition metals here. Hair contsains lots of disulphide bridges, alkaline hydrolysis cleaves them, and sulfides can be used in these kinds of reductions.

Bleach also affects the disulfide bridges, which would explain the lesser effect of bleached hair, oxidizing the sulfur to sulfonate presumably inactivating it.

[catcatcatcatcatcatcatcatcatca]

Panel one: Publish fake research about using human hair as catalyst
Panel two: Chemists finally get a haircut to verify the claims
Panel three: Chemists ask someone else to donate the hair
Panel four: Chemists ask someone else to donate the hair

[chsovi]

I love videos verifying weird chemistry papers, please make more!

[kevincuevas]

Im a bit late to this, but red hair is caused by the pheomelanin pigment molecule which contains sulphur associated with asiatic melanin, compared with the native european/african type melanin called eumelanin. Also interesting convergent and ancient common ancestral evolution of these melanins are found in the animal kingdom elsewhere. Cats are known to have pheomelanin as well. Both Eumelanin and Pheomelanin are made with Tyrosine, but Pheomelanin has a sulfur compound that produces the specific reddish yellow hues seen in these pigments at various sizes a cross humans

[notthatcreativewithnames]

The main component in human hair is keratin, a protein, so I guess that the hair in NaOH solution would probably be a oligopeptide mixture (or even a mixture of amino acids) as a result of base-catalysed hydrolysis of keratin. Therefore, I think that the key players in the reduction of nitro groups might be amino acids or oligopeptides rather than trace amounts of metal ions. We can probably test this by using fingernail clippings (also made of keratin), whey protein powders (different types of protein), or mature cheddar cheese (partially broken down protein) instead of human hair.

Also, because amino acids are generally chiral (except glycine), they might work well when you want stereoselective reactions.

[pialamode]

If it’s the transition metals in the hair that do this I wonder if it’d work with blood- plenty of iron in that! You could even compare the yields from different blood types like how they did different types of hair.

[AustinSteingrube]

When I was taking chemistry in high school, my lab partner and I were always the first ones to finish labs, so we would typically spend the rest of the period melting pennies and other random objects to kill time. You know, basic high school antics.

Well, one day, we were doing the reactive metals lab which started with putting magnesium in water to make the hydroxide and hydrogen gas. Of course, the next step in the lab was to burn the magnesium using a bunsen burner as the heat source. It lit up as normal and we proceeded with the lab…skipping the step where we were supposed to turn off the burner. Obviously, this was a penny melting day.

We move on to the sodium part. We were given small chunks to put in water and take note of how much more quickly hydrogen gas was produced. We drop the sodium in, watch it bubble and fizz for a few seconds, and then heard the teacher screaming, “TURN IT OFF! TURN IT OFF!”

We look back to our bench to see that the bunsen burner’s flame, only a few inches from the flask, had turned a red orange color. A split second later there was that characteristic “FWOOOOP!” sound as the flame got sucked into the flask and ignited the hydrogen.

No one got hurt and nothing exploded, but it is still one of my favorite lab memories.

[Atmix]

Gives a whole new meaning to 'hair metal'

[mattabesta]

This to be done where the dissolved hair mix is treated to remove trace metals with a chealator or some other method, I refuse to believe the tiny metals in hair are doing this.

[seneca]

This should be tested with hair from redheads. Then you could say that ginger chemistry works in addition to carrot chemistry.

[e_gorrr]

Modern organic chemistry becomes more and more looks like a dark magic.

[stephenjacks]

Reduction of the nitro dates back to 1800s and includes many reactions. Reduction using metallic Iron and Sulfur compounds was used industrially. The Thiols in Hair would be expected to react like other Sulfur compounds.