Genetics is a Piece of Cake

You’ve probably heard of genes, but how does that four-letter code translate into the physical stuff of life? To explain, I bake a cake, using a recipe written with just four letters.

I’m on social media!

----------------------------------------------------------------

If you want to donate to this channel, I now accept cryptocurrencies! Also, thanks!

BTC: 1NYSD5Nbxs1pD9bqnhHForXvofRphcRdF7
BCH: 1MXZVz1Sy4xTxrGHo6dQcZtsArtjWLCyp
LTC: LUKB8Xh6nrrASH9rEmymMvjhUH3f6NWJiN
ETH: 0x02032DCF55148e06C579aB0F7C9c4241cC3ce6b8

----------------------------------------------------------------

If you want to make the recipe, you should seek counciling, but here is the key and recipe:

AUGACACUACCGAGAUUUUUAGCUUUAAGGCGCGGUUCAAAGCUCUUGCGGUCAUCAUAUUUGACGGAUUUAUUACGUGAUUUGCUGUUGCUCCUCCCUGCUCUGUUGCCCGUCCUUGGCCUGCGAACUACCCGCCGUCUAUUGCUCUUAAUUCCUGCGUCGUGCUCUCGACUAACUUUGGGCCUAUUGGGGUCAACGACCGGCCCCGACACGGAUAGACUCCGCAGACUCACCAGAAGGCUUACAACUACUCGGCUAGUAGGUCUCGUCAAAAGACUUGCGGUUACAUCCGUUGAGCGUACUCCUCCUCGAGGUCUGCCCUUAUUGGUUUCGCAUGCGGAACCAAUCUACCUUGCAGCCUUGAGAUCAGGGCGAAGGUUGCCGGCCCCCGGAGCUGUAGGAACAACGCCCGCUUUACCGAGAGGGCUGACAGUACUACGGGAUGGGCGUAUCGGCCUUUACAAACUGGCGCUCCUGCUCCGCUCACGACGUUUGUGUCGGCGUCCACUGCUGCGACGCCUCCGCCGGUUAGUAUAUAGGCGCCUAUUAGCACUAACCCCAACAUCUUUGGCUAGGACAGCGCUCUUACAGCUGUCGACACCUACGCAAGGUGGACGCCGUUUAAACCUACUUUCCAGGACGUUAACGGGACGAGGCCUUUUAACGCUUCUAAAGUUGGCCGGAUUCAGGGCACGCACUAGGAUACUAGUGCUAGUUACCUUAUCUGCCCUGCUACAGUUGCUUACAACGACCACCCGACUAUUAACUCUCCAACUUCCACUUCCGCGGCGGAUCAUAUACGACCCACUCCUGGAUCUUGACCUGCUGACUCUGGACCGGAUUAAAGUGAUACCUGACACUAUCGUGGUGUUAGUGCGUACAUCCGGCAAAAAGGGCCUCGUCCGCCCACUACGGACGGCACUGUAUCGCUCUCUCCUUGGGGUAUCCUUAUCCGGUCUCUCGGAAACGCGUGGUCGAUUACGUACUCGGCUGACACGUAGGCUCUUACGGCUCCUGCUCUCGGCCCUUGGUAAGAGAGCCGAGAAGACCCUGACCCUCAAUCUGCCGAAAACUUUGCGAACCGUCGCCGAAUCGUCCGCUCUAGAGAGGUUGCUUCUUACAUUGUGGACGUUGACCCGAAGAAGGCUAGUUCUACGGAUUGUUGUAAUACCCCGCCUUUCUAGAGCACGAUCUACUUUGCCGCUUCUAGUGGCUCUACUUAGAGUCCUUAGAAUUCGUACCGUCAGGUUAUAA

----------------------------------------

This is the first cake that I've ever made the recipe had 418 steps.

Genes are the recipes that make life and we have a lot of them. If you wanted to print out all of the genetic information in an
individual on paper, you'd have to fill 67 cabinets.

We have around 20,000 genes that make proteins in our bodies. And to make that a little more palatable I want you to pretend that instead of 'genes that make proteins' were talking about 'recipes that
make cakes' I'll explain.

Just like genes, recipes evolve - the good ones get passed on. If I make a cake and it tastes good, and I give the recipe to my friend, and
if they like the recipe they might pass it on to their friends, and maybe
somewhere along the line someone modifies it and puts in more sugar and that recipe gets passed on even more.

They change and they evolve over time.

But, if I made a recipe that tasted like socks and I passed that on to my friend, well, I'd be mean and also my friend probably wouldn't pass it on. So just as with recipes, if you have genes that make you
more successful (more likely to have offspring), those genes are more
likely to get passed on.

My mom passed recipes onto me and she also passed her genes on to me, roughly half of my DNA comes from my mom and from my dad and I say roughly half because I share more DNA in common with my mom than with my dad. It isn't a perfectly even split and a lot of things get garbled up when they get passed on. It's a messy process
but it's that messiness that makes me different than anyone else.
It makes my recipes different than anyone else is.

But those differences are really small. Even though it takes a whole 67
cabinets to write out my entire genome it only takes about this much, 210 pages double sided, to print out the things that make me genetically unique. If these are all recipes then this is my special
spice.

Okay so maybe by now you get the basic idea of inheritance but genetics still seems very complicated. So in order to make it as simple as a piece of cake I'm going to make a piece of cake with a
recipe that is 418 steps. If you've ever looked for cake recipes online you probably had to sift through a bunch of other stuff, there's ads, a review, comments, notes, and buried in there somewhere is the actual recipe. Our genes are a lot like that. Most of them are actually junk and just a fraction are important instructions.

The first thing you'll probably notice about this recipe is that it's only
written with four letters: A, U, C, and G. I wrote it that way because our genetic code is also made of just four letters.

So here's how I fit 20 different ingredients and 20 different measurements into those four letters... its all in the video!

Thanks for watching!

[ScopeofScience]

Sharing this video is a piece of cake!

[ninjanerdstudent]

Vsauce, Veritasium, Kurtis Baute, ...

Is this the future of learning science?

[fakeman]

such a shame you are a 'small' youtube because you make these videos with passion and hard work and you deserve 5 mil subs <3

[drKibarashi]

@3:30, its actually ATCG. T=thiamine and found in DNA, while U=Uracil, found in RNA. DNA does not make proteins, DNA is transcribed to RNA (various forms like messenger, transfer etc.) that are then transcribed into Amino acid sequences that then get folded into a specific structure that then becomes a protein...

[robotelbows]

Dude! Love this. Keep going, this was awesome.

[ninjanerdstudent]

I have never thought of genetics like this before. Your channel is going places, buddy.

[Chrovos]

I’ve learned so much from your videos over the last year but I wish you’d upload more

[RadhakrishnaSharma]

Wow, a whole new perspective. I'm so glad you make these videos.

[TheReaperKing]

Got to say i love how you did this, as a pastry chef this hit me right where it should nice one. These simple yet smart ways of explaining things is how people should teach if my science teacher did this i think we would be much happier.

[ninjanerdstudent]

*_VEGAN_* Vanilla Cake Recipe.




Nice.

[jenniferschepens]

I loved this video, you deserve way more recognition. But I am sure you will get there. Keep it up! :)

[Synky]

You really do deserve more subs. Great video!!! Keep at it and you'll be popular in no time. (I just discovered your videos, so I'm sure there's millions more to come)

[TimCJ]

This is so cool! it summed up 2 weeks of bio into 7 minutes 38 seconds.

[andresshch]

I guess the cake represents 1 protein, as the RNA takes 3 letters (as you showed) to make one aminoacid. And the mixture of all the ingredients makes the cake, as thee sequence of aminoacids makes a protein. Am I right?

[cowcar]

Keep up the great work. Enjoying your enthusiasm and clear methods of explanation

[brianwyters]

If I tried that, the ingredients would spoil by the time I finished mixing the ingredients.

[rawvid]

Wait, I don't know if I am wrong but I think it was a t g c, not augc

[freshforreal]

Such a great video I’m kind of new but you have a great channel keep it up

[epicjoer]

Shouldn't u use pairs instead of triplets, after all genetics use base-pairs (adenine-thymine, guanine-cytosine)

[HoboNico]

Guy- does the equavelant of a cell but in 2 hours
Cell-noob