How Does COVID-19 Testing Actually Work?

Sars-Cov-2, the virus that causes Covid-19 is easily the most defining feature of 2020. In the last 8 months the world has changed radically and there have been plenty of fumbles as countries struggle to deal with the chaos. One of the most important issues has been testing for the virus. In this video, I aim to demystify how that testing actually works down to the chemical level and show exactly how it's done. We'll be covering the viruses anatomy, as well as three types of test: PCR, LAMP and Antibody.

Earlier videos:
___________________________________________________________________
Try tab for a cause today:
___________________________________________________________________
00:00 - Introduction
04:00 - Virus Anatomy Overview
09:45 - PCR Overview
13:30 - Performing PCR
20:37 - Testing at Scale and Robots (Opentrons)
23:30 - LAMP overview
27:50 - Performing LAMP (Biofoundry)
30:30 - Pros/Cons of Genetic Tests
31:30 - Antibody Overview
32:50 - Performing Antibody Test
34:00 - How Antibody Tests Work
38:00 - Summary
____________________________________________________________________

Support the show and future projects:

______________________________________________________

Our Social Media Pages:

_____________________________________________________

More resources, and citations:

_________________________________________________________________________________
SpikeF - AGGAATTTTTATGAACCACAAATCA
MembraneR - CGGTGATCCAATTTATTCTGTAAAC
NucleoF - AAATGAAAGATCTCAGTCCAAGATG
NucleoR - ACAGTTTGCTGTTTCTTCTGTCTCT

Original Primers:
N1F - GACCCCAAAATCAGCGAAAT
N2F - ttacaaacattggccgcaaa
N3F - GGGAGCCTTGAATACACCAAAA
N2R - GCGCGACATTCCGAAGAA
N2-LF - gggggcaaattgtgcaatttg
N2-B3 - gacttgatctttgaaatttggatct
N2-F3 - accaggaactaatcagacaag

[thethoughtemporium]

SpikeF -
MembraneR - CGGTGATCCAATTTATTCTGTAAAC
NucleoF - AAATGAAAGATCTCAGTCCAAGATG
NucleoR - ACAGTTTGCTGTTTCTTCTGTCTCT

[Bigfoot_With_Internet_Access]

Luckily I've managed to avoid getting it so far by hiding out here in the deep forests

[alexandrelanhoso]

I love how he casually use peas as coolant for his biological raw materials.

[Ididathing]

i should have watched this video before i tried

[Spit]

Im 26 and had covid. I had symptoms for about 16 days. It felt like a moderate cold but with severe soreness and pain in my joints, especially my legs. I have moderate asthma and my breathing was easily controlled with my inhaler. I’m also a microbiologist so this whole pandemic has been extremely interesting. This is a great video.

[debug]

watching this in 2024 feels weird. a look back 4 years ago while not feeling it was 4 years ago

[zuthalsoraniz]

Meow Ludo Disco Gamma Meow Meow has to be the most cyberpunk name I've heard, at least for a real-life person

[princesscheeseburger]

Back when the death toll was only 700k 😢

[StormBurnX]

it is INSANE how far you have come from the first videos I saw (the radio telescope/"wifi camera" adventures). the quality of science, recording, narrating, and overall production has jumped vastly; the scale and capability of your lap and tools have expanded as well; and perhaps most importantly, your passion for science and earnest pursuit of spreading knowledge has never yielded.

Keep up the good work, keep yourself safe, and don't forget to take breaks sometimes so you don't burn yourself out!

[DrakkarCalethiel]

PCR= Pipette, Cry, Repeat. Never change! 😂😂

[desmond-hawkins]

Meow-Ludo Disco Gamma Meow-Meow is such an amazing name. Looking him up, I learned that he got in trouble for implanting his public transport card chip into his hand and was fined and summoned to court for traveling without a valid ticket (the judge dropped the case). Sounds like an interesting friend :-)

[JustOneAsbesto]

*L* (oop mediated isothermal) *AMP* (lification), I assume.

[ernestkirstein]

Great video but I kind of laughed at the end. Putting a "listen to the scientist" spiel at the end of a 40 minute technical video on covid testing is the definition of preaching to the choir.

[jpjude]

15:03 Ah yes, the most used refrigerant agent in biolabs : frozen peas! :D

[MoritzvonSchweinitz]

at about 31:00 you state that people with past infections don't PCR test positive - actually, a surprising amount of people test positive weeks after a passed infection, due to "genetic garbage" still hanging around. These patients are, according to WHO standards, not considered infectious patients anymore.
Do you know what this "genetic garbage" actually is? How long can naked pieces of RNA just hang out on mucous membranes?

[haydennorris]

I clicked as soon as I saw the patreon notification. Fantastic job on the animations. I can tell you really put your blood sweat and tears into this project. (sometimes literally) I also really appreciate that you didn't pull any punches for anti-maskers and conspiracy theorists. It's a bummer bad primers caused you so much trouble but I think the final product is some of your best work. I'm pretty hyped for the upcoming spider silk video. Keep up the good work Justin!

[charles]

as a scientist like yourself, do you ever question the origins of COVID? do you think that there is anything you find uncertain or questionable about the virus?

[Luko]

It makes me happy to know that there’s 80, 000 other people out there who are actually interested in how things in the world work

[kurtnelle]

I can't believe I sat through this looong video about a field of science that I knew nothing about and actually learned something. This is some high-quality content.

[drugsrthugs]

He really put his blood, sweat, and tears into this video. He pricked his finger, did some pipetting, crying and repeating, and worked on this video for months. Awesome video.