ChatGPT gets another insane new buff

OpenAI just released a new ChatGPT plugin marketplace allowing businesses to integrate their own custom apps. In addition, it has a new "browser plugin" for Internet searching and "code interpreter" for python execution.

#ai #tech #TheCodeReport

💬 Chat with Me on Discord

🔗 Resources

🔥 Get More Content - Upgrade to PRO

Use code YT25 for 25% off PRO access

🎨 My Editor Settings

- Atom One Dark
- vscode-icons
- Fira Code Font

🔖 Topics Covered

- What are ChatGPT plugins?
- Can ChatGPT search internet?
- Executing code with ChatGPT
- What is a vector database?
- Running Python in ChatGPT

[fullmetaltheorist]

"There are decades where nothing happens. But there are days where decades happens."

This is the Ai version of the quote. We are really going at light speed

[ilkou]

Ma man is putting as much content as he can before AI takes over 😂❤️

[RollingStride]

It just isn't a good day without a code report video anymore.

[extium]

Let it be known I've loved technology since I was introduced to toasters. I love AI and robots and would never harm even a micro controller!

[alansmithee]

I think one of the big things AI is gonna do over the next few years is just look through all our scientific papers and make obvious connections and discoveries that we haven't simply because no human has ever seen the two relevant bits of information needed to make the discovery. There's got to be tons of stuff that's obvious based on what we know, but that no human has noticed simply because they haven't had the opportunity to. An AI that can just scan all our research? Pretty cool.

[DedzixYT]

The pace AI is improving at is insane it's only been like 4 months since chatgpt came out I have a feeling every industry will be struggling to keep up with it for a while

[luissg]

How do we know Jeff hasn't been already replaced by a GPT that works 24 h to generate AI-content?

[MightyElemental]

I really wasn't expecting to see an AI revolution this early in my life. This is actually terrifying. I'm almost done with studying Computer Science at uni, but now I don't even know what the point of it was now that cgpt4 exists and will only continue to improve.

[tanneraustin]

I know a lot of people keep saying that devs/programmers/ IT people have nothing to worry about, but that isn't inspiring a lot of confidence. With a sufficiently powerful AI, a business owner could describe in simple English what they need out of their enterprise software and the AI could crap it out over the lunch break. After it gets to that point, we might not be good for much besides running ethernet cable and building the data centers it needs to support itself.

[TypeScriptTV]

Let's run a Turing Test on Jeff to verify if he's human or machine!

[catcatcatcatcatcatcatcatcatca]

I’m sure this sudden race between big companies to release their own APIs and chatbots and give them as wide as functionality as possible has not compromised their commitment to alignment and AI safety.

Because that would be frightening.

[HKJeffer]

Chat as UI is not always ideal since often customers have no idea what they want or how to phrase it unless a GUI shows them the options.

[AnotherEmptyDream]

Honestly the speed this content is coming out is equivalent to the pace my heart makes when I hear the terrifying future we are coming to.

[ncsmusicandremixes]

I almost got a job in an MNC using GPT-3. Used it for the code test and interviews. Passed both stages quickly. I didn't get the job as they didn't give sponsorships and I was supposed to have Permanent residency in the country. It's scary good.

[whitenightmare]

We are getting daily code reports, soon we will need to use the AI to generate code report videos twice a day about the advancements in AI.
Unless the scripts are already written by GPT-4.

[udaya]

It's great to have code report daily nowadays 🤣

[andreyi]

In tomorrow's code report: Chat-GPT4 just created Chat-GPT5. Everyone from OpenAI is fired, as there is no more need for humans in the industry. Also, if you were thinking that we live in a simulation, fear not, as Chat-GPT5 is modeling your conscience in a virtual format, making you completely irrelevant in the online domain. It's been a fun ride, everyone

[rinzler_d_vicky]

We have come full circle, we started from text prompts to interact with the machine to all the facy UIs of the 2020s and now back to text prompts we go!

[RhumpleOriginal]

Imagine having NPCs that have knowledge of the lore in the game in a limited capacity based on their character and expand on that with stuff they might see. Detective games would be awesome.

[Vondaelen]

Your content has been absolute fire from the first moment I laid eyes on it. Insightful, funny, sharp. If you do not have your own Netflix show (but you'd like one!), I hope you get one very soon.