Uncovering the Chemicals Involved in the East Palestine Train Derailment

How bad is it? Sorta bad, but it has impacted the lives of many local people greatly.

A lot of people asked me to make this video, I think I have had over 30 people request this video.

A huge thanks to Aldous, Mfernflower, Turtle, and Opossum Supremacist for their help :) I also want to thank Nathan.

----------------------------------------------------------------------------------------------------------------------------------
References:

----------------------------------------------------------------------------------------------------------------------------------

[RangerOfTheOrder]

The strangest part of this whole incident was the lack of media coverage it received for the first week. I live about an hour from East Palestine, and I didn't hear about this until the 10th.
It's just weird and slightly concerning.

[DrConrad]

It's important to remember that Norfolk Southern spent more than 14 billion dollars on lobbying that ended up preventing legislation passing that would require safety inspections to be checked by humans as well as an automated system - one which failed spectacularly in this event to warn the engineer of an axle failure. Instead of investing in this safety precaution, they chose to purchase stock buybacks instead. The poor government regulations in place are directly the fault of rail companies lobbying to cut costs at the expense of health and safety. The responsibility of this disaster lies solely with the rail company in this instance.

[catcatcatcatcatcatcatcatcatca]

This was something that the railworker union had been warning about for years. And instead of fixing dangerous laws written by lobbyists, the government choose to take away their right to strike.

Derailings in USA are a daily occurrence. As long as derailings are profitable, they are tolerated, regardless of the obvious risk to communities, workers and environment. Preventing derailings would cost more to these companies than the actual derailings, and there is no law forcing them to take responsibility or implement proper safety measures.

In the eyes of government, measuring time spend in safety inspections in seconds in order to cut personel costs is entirely normal, but workers striking would put the whole nations economy in jeopardy.

You’d think the economic risk would warrant few more seconds to inspect the axels properly, and not postpone repairs?

[fungalcoffee]

One of the most disconcerting thing about all this is I've heard 10x more information about this form YouTube and social media than I've heard from my local or national news. This was not a simple accident and you would think it would have been huge news for at lest a day or two.

[Ciel_DJ]

Follow the money - Norfolk Southern is owned by Vanguard, JPMorgan and Black Rock. I wonder if that was the reason why it's received so little coverage

[Jeff-]

The smoke from the controlled burn was very black. I would hardly call that complete combustion.

[HapppyMann]

burning chlorinated hydrocarbons rarely ends well, won't be supprised to see higher cancer rates there in the future

[mymomismydadsmom]

Was waiting for someone like you with actual knowledge to opine on this.
Thank you! This actually clears things up.
Wish we could clear this location up for them

[crystalthewolf]

I live 150 miles away and got acid rain last week, nearby towns are having water contamination issues with butal acrylate being found in a few near me

[michaelimbesi]

If you want to know the actual sequence of events leading up to the derailment, CCRX is a youtuber who works as a railway maintenance worker and made an excellent video on the subject.

[spacekowboy]

I'm 30 miles south. Our water just tested positive for butyl acrylate. It comes from the Ohio River.

[PandamaticBreakcore]

I'm an environmental chemist and I specialize in contaminants. This isn't great but it's not a disaster. It needs to be monitored because it's a chemical spill but honestly we do worse any time we incinerate a sizeable quantity of garbage (which is every day in a lot of places). What IS serious, is that the protocols to prevent this were neutered by money from a chemical company. Next time, it could be something a lot more horrific than vinyl chloride.

[dylanwebb]

Thank you for doing this, it isn't getting the coverage it should have

[LavenderSkyla]

Yeah. Chernobly was kept quiet too. People told nothing to worry about and then evacuated way too late. If I lived around there I'd leave immediately

[Schweitzerwelsch]

Something really crazy is that in Europe at least in Switzerland and France we have absolutly no information about this major incident on public TV news or newspaper since the beginning.

[gamemeister]

I think the most concerning thing then is the lack of media coverage leading to people, like myself, thinking it could be much much worse long term. Thanks for the info!

[MissionaryInMexico]

Not super bad? Who are you kidding? This is a major disaster.

[Taladar]

I am not an expert but all that soot in those flames there at the end of the video don't look like complete combustion to me.

[emeraldflame]

Thank you so much for covering this. As an Ohioan that has seen very little coverage of this catastrophe, I'm grateful for anyone who covers it.

[revenevan]

The nefarious parts of this are the lack of coverage initially, the arresting of journalists, and the rollback of safety regulations that could've prevented it. Other than that, I hope you're right that they're handling this correctly... but I've watched too many "Plainly Difficult" videos to believe that initially lol.
Either way this stuff will continue to happen until *executives* see substantial prison time in the wake of such disasters. Monetary penalties are just the cost of doing business, and their offer of $25k for the entire town is disgusting.