Harder Drive: Hard drives we didn't want or need

In this video we make and evaluate several hard drives that we didn't want. Drawing some inspiration from vexing current events, we find that creative, structured thought on adjacent (but frivolous) problems is a sort of digestive act, and one that is ultimately laxative.

Errata (thanks to all pedantic viewers who catch this stuff):
- I got the escape velocity off by a factor of 1000! It's 11 km/sec, not 11,000 km/sec. I think the other calculations are correct; I just mistook a period for a comma in my bleary-eyed late-night editing.
- I got the size of the genome wrong due to a very silly bug from bleary-eyed late-night programming. It is 29903 base pairs, which can be stored in an economy-sized 7476 bytes.

For SIGBOVIK 2022

[Natibe_]

I can’t believe it. This man did it. He downloaded more RAM.

[catcatcatcatcatcatcatcatcatca]

“Tetris is a an inventory management survival horror game” is one of the best jokes I have heard this year.

[TheWretchedOwl]

You know, a chainsaw could either be turned on or off, much like a bit, 1 or 0. So if you become a machine that would both catch chainsaws and launch them into orbit at a steady rate, as well as determine if each chainsaw is on or off, and has the capability to turn the chainsaws on or off itself, then you could in theory build an orbital chainsaw drive capable of storing and retrieving data, right?

[stromsky]

I found myself suddenly aware that I need to expand my friend pool when I could not think of any one I could share this video with who would properly appreciate it.

[SollowP]

"We can of course ignore air resistance"
Spoken like a real engineer.

[HBMmaster]

opening this video with a story about juggling arbitrarily many chainsaws is so good. immediately hooked

[theoebola]

24:52
> bandits dont have access to the data
I could only imagine the horror a potential hackerman would experience if they discovered that the secret data they are looking for is stored in this mind-boggling fashion

[jacobstory]

"Why not ping the whole internet? So I did." Absolute madman!

[benhuyck]

Tom7: “I don’t want to lose my data.”

Also Tom7: *stores data in transient virtual ping pong balls*

[MrGeorgeFlorcus]

I love that we go from a dude juggling 1.2 trillion chainsaws in an elliptical orbit around the Earth, to, "We can now look at the entire internet" in like 4 minutes

[Nacalal]

For some reason, the idea of storing data in active network transmissions makes me feel an uncomfortable sense of panic in the same way standing against the window on the top floor of a skyscraper does.
It's that sort of "I know it's safe, the chance of failure is extremely minimal, but there's no way in hell I'm risking it" sensation.

[ticklefights]

The ultimate hard drive is the equations that govern the universe. If you want to know what your data was at any given time, you just play the simulation back up to that point and have a look.

[Hyraethian]

This entire video felt like, "okay bear with me." and I loved it. That map of the internet was so pretty.

[cortster]

1:00 As hilarious as it is to imagine a chainsaw going 11, 000km/s, the escape velocity of Earth is actually just ~11km/s.

[robertstevensii]

58 seconds in. I never want this ride to end. Better than 99 percent of entire videos so far.

[Spolt_main]

9:29 the madman did it, he pinged @everyone.

[BillyBobCornontheCob]

Singlehandedly causing a new 'do not use for arbitrary storage' clause to be added to terms of service across the world

[masonaut]

15:15 “Tetris is an inventory management survival horror game.” Couldn’t have said it better myself

[SEVEN]

At 8:00, be fully aware - some people have their ISP (gateway) "node" set to ignore/"block" to ICMP/echo requests; this is why these maps are always incomplete.

[RealBelisariusCawl]

“Aww, I can only ping 1, 000 times a second. It’s almost like somebody THOUGHT OF THIS”

Jokes aside this is fantastic work. ❤