Leetcode 187. Repeated DNA Sequences in Python | Python Leetcode | Python Coding Tutorial | ASMR

Leetcode 187. Repeated DNA Sequences in Python | Python Leetcode | Python Coding Tutorial | ASMR

The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'.

For example, "ACGAATTCCG" is a DNA sequence.

When studying DNA, it is useful to identify repeated sequences within the DNA.
Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

Example 1:
Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC","CCCCCAAAAA"]
Example 2:
Input: s = "AAAAAAAAAAAAA"
Output: ["AAAAAAAAAA"]

Please don’t forget to Like ,Comment and Share the Videos!
Each and every Like , Comment and Share helps us!

Thanks for Watching🙏😍😘

Please Subscribe to watch more videos.

In case of any copyrighted Content, Please reach out to us.

* Hope you like it

📷 Welcome to Code is Art! 👨‍💻

🔗 Follow us on social media:

Join our coding community and follow us on Instagram for coding inspiration 🎨, GitHub for code collaboration 🐙, Twitter for coding updates 🐤, Reddit for coding discussions 🤖, Facebook for coding news 📚, YouTube for coding tutorials 🎬, and Discord to connect with fellow coders and share your experiences 🎧. Let's grow our coding skills together! #CodeIsArt #FollowUsNow 👨‍💻💻🐤📱📚🎬🎧

#leetcoderepeateddnasequences #leetcoderepeateddnasequencesalgorithm #leetcoderepeateddnasequencesexample #leetcoderepeateddnasequencesinpython #python #leetcode #leetcodeinpython #asmr #asmrcoding #asmrprogramming #howtolearncodingforbeginners #learntocode2025 #howtolearntocode #learnpythonprogramming2025 #pythontutorial #howtolearncoding #howtocodeleetcoderepeateddnasequencesinpython #howtostartcodingforbeginners #learncodingforbeginners #learnpythonprogrammingforbeginners #datascienceinterviewquestions #faangcodinginterviewpreparation #faangpreparation #placementscodingpreparation #interviewcodingquestionsandanswers